Sequence ID | >WENV180095197 |
Genome ID | MTBK01055021 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 198475 |
End posion on genome | 198401 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
cagttttcac |
tRNA gene sequence |
GGCGCCTTCGTCTATCGGTTAGGACGCAAGATTCTCATTCTTGAAAGAGGGGTTCGATTC |
Downstream region at tRNA end position |
cctttactca |
Secondary structure (Cloverleaf model) | >WENV180095197 Glu CTC c ACCA cctttactca G + T G - C C - G G - C C - G C - G T - A T T T T C C C C A C T A C | | | | | G G T C T G A G G G G C G + | | | T T T G G A C T A G AAAG C - G A - T A - T G - C A - T T T T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |