Sequence ID | >WENV180095213 |
Genome ID | MTBK01056139 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1549 |
End posion on genome | 1633 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gctgtattaa |
tRNA gene sequence |
GCCGAAGTGGTGGAACTGGCAGACACACATGCCTTAGGAGCATGGGGGAGAATATCCCGT |
Downstream region at tRNA end position |
atacttaact |
Secondary structure (Cloverleaf model) | >WENV180095213 Leu TAG a Atag atacttaact G - C C - G C - G G - C A - T A - T G - C T G T T C T C C A C A A G + | | | | G T G G T G G G A G G C G | | | T T G A C A C C A G A GGGGAGAATATCCCGT C - G A - T T - A G - C C - G C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |