Sequence ID | >WENV180095217 |
Genome ID | MTBK01056523 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 15898 |
End posion on genome | 15969 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tacaccacag |
tRNA gene sequence |
GCGCCTATCGTATAATGGTATTACCTCAGCCTTCCAAGCTGAAGAAGCGGGTTCGACTCC |
Downstream region at tRNA end position |
ggcccccccg |
Secondary structure (Cloverleaf model) | >WENV180095217 Gly TCC g TCtc ggcccccccg G - C C - G G - C C - G C - G T + G A - T T C T T G C C C A A A C + | | | | G T T A T G G C G G G C G | | | T T G T T A C T A C AGAA T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |