Sequence ID | >WENV180095221 |
Genome ID | MTBK01056681 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1099 |
End posion on genome | 1014 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ataaggacgt |
tRNA gene sequence |
GCAGGCGTGGCGGAATTGGCAGACGCGCTAGACTTAGGATCTAGTGGGCAACCCCCGTGA |
Downstream region at tRNA end position |
tttattttca |
Secondary structure (Cloverleaf model) | >WENV180095221 Leu TAG t ACCA tttattttca G - C C - G A - T G - C G - C C - G G - C T C T C T C T C A T A A G | | | | | G T G G C G G A G A G C G | | | T T G A C G C C A G G TGGGCAACCCCCGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |