Sequence ID | >WENV180095236 |
Genome ID | MTBK01057827 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 460 |
End posion on genome | 370 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tacatagtag |
tRNA gene sequence |
GGAAGAGTGCTGGAGCTTGGTTGAACAGGCAGACCTGGAAAGTCTGTGTGCCCTCAAAAG |
Downstream region at tRNA end position |
tcatccttag |
Secondary structure (Cloverleaf model) | >WENV180095236 Ser GGA g GCtt tcatccttag G - C G - C A - T A - T G - C A - T G - C T A T C A C C C A T C G A G | | | | | A T G G T C G T G G G C G | | | T T G A C A G T T G A G TGTGCCCTCAAAAGGTACC C - G A - T G - C A - T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |