Sequence ID | >WENV180095254 |
Genome ID | MTBK01058949 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1461 |
End posion on genome | 1536 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tccgcgcttc |
tRNA gene sequence |
GCCGGTGTAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGTCAGTTCGAGT |
Downstream region at tRNA end position |
gacaggatcc |
Secondary structure (Cloverleaf model) | >WENV180095254 Thr CGT c ACCA gacaggatcc G - C C - G C - G G - C G + T T - A G - C T G T C A G C C A T G A A | | | | G T C T C G G T C A G C G | | | | T T G G A G C T A A AGGTC G A C - G G - C C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |