Sequence ID | >WENV180095287 |
Genome ID | MTBK01060872 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 160967 |
End posion on genome | 161042 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ccaattagaa |
tRNA gene sequence |
GCCTTCTTAGCTCAGCTGGTAGAGCAGCTCATTCGTAATGAGCAGGTCGCGGGTTCGAGT |
Downstream region at tRNA end position |
aacaaagtgg |
Secondary structure (Cloverleaf model) | >WENV180095287 Thr CGT a TCCA aacaaagtgg G - C C - G C - G T - A T - A C - G T + G T G T T G C C C A C G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTC G - C C - G T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |