Sequence ID | >WENV180095301 |
Genome ID | MTBK01061012 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 12 |
End posion on genome | 105 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tttccataga |
tRNA gene sequence |
GGAGAGTTACCGAAGTGGTCGTAACGGGATCGACTCGAAATCGATTTAGGGGCCACAAGC |
Downstream region at tRNA end position |
gttcctgcaa |
Secondary structure (Cloverleaf model) | >WENV180095301 Ser CGA a GCCA gttcctgcaa G - C G - C A - T G - C A - T G - C T - A T A T C C C C C A G T G A A | | | | | G G A G C C G G G G G C T | | | T T C A C G G G T A G TTAGGGGCCACAAGCTCCTAC A - T T - A C - G G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |