Sequence ID | >WENV180095303 |
Genome ID | MTBK01061247 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1078 |
End posion on genome | 988 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ccgtccccgc |
tRNA gene sequence |
GGAGGGATGGATGAGCGGTTTAAGTCGCACGCCTGGAAAGCGTGTGGGGGTTAACAGCCC |
Downstream region at tRNA end position |
ggtgcctgcg |
Secondary structure (Cloverleaf model) | >WENV180095303 Ser GGA c GCCA ggtgcctgcg G - C G - C A - T G - C G - C G - C A - T T A T C G C C C A C G A G | | | | | G G G T A G G C G G G C G + | | T T T A G T C T T A G TGGGGGTTAACAGCCCCCC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |