Sequence ID | >WENV180095305 |
Genome ID | MTBK01061526 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 125 |
End posion on genome | 209 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atttaaaaat |
tRNA gene sequence |
GCGGATGTGGTGGAACTGGCAGACACGCTGGATTTAGGTTCCAGTGGGTAATTCCGTGGG |
Downstream region at tRNA end position |
tggaatctaa |
Secondary structure (Cloverleaf model) | >WENV180095305 Leu TAG t ACCA tggaatctaa G - C C - G G - C G - C A - T T - A G - C T G T T T C C C A C A A G + + | | | G T G G T G G G G G G C G | | | T T G A C A C C A G G TGGGTAATTCCGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |