Sequence ID | >WENV180095322 |
Genome ID | MTBK01062375 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 46940 |
End posion on genome | 46866 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tgtgccgtga |
tRNA gene sequence |
GCGGGCGTAATTCAGCGGTAGAATGTCAGCTTCCCAAGCTGGACGTCGCCGGTTCGAGCC |
Downstream region at tRNA end position |
ttttcgccga |
Secondary structure (Cloverleaf model) | >WENV180095322 Gly CCC a TCCA ttttcgccga G - C C - G G - C G - C G - C C - G G - C C G T T G G C C A G A A + | | | | G C C T T A G C C G G C G | | | | T T G G A A T T A G ACGTC T + G C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |