Sequence ID | >WENV180095333 |
Genome ID | MTBK01063284 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1856 |
End posion on genome | 1941 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttatagtcgt |
tRNA gene sequence |
GGAGAGGTTCCCGAGTGGTCAAAGGGATCAGACTGTAAATCTGCTGTCAGATGACTTCGG |
Downstream region at tRNA end position |
gtagatttta |
Secondary structure (Cloverleaf model) | >WENV180095333 Tyr GTA t ACCA gtagatttta G - C G - C A - T G - C A - T G - C G - C T A T C C T C C A T G A T | | | | | G G G C C C G G A G G C G | | | T T T A G G G C A A A TGTCAGATGACTTC T C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |