Sequence ID | >WENV180095337 |
Genome ID | MTBK01063464 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 7799 |
End posion on genome | 7709 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cgaaagacac |
tRNA gene sequence |
GGAGAGATGGTCGAGTTGGCTGAAGGCACCGGTCTTGAAAACCGGCGAGGATGCAAGTCC |
Downstream region at tRNA end position |
atatccctta |
Secondary structure (Cloverleaf model) | >WENV180095337 Ser TGA c GCCA atatccctta G - C G - C A - T G - C A - T G - C A - T T A T C G C C C A T T G A G | | | | | G G G C T G G C G G G C G | + | T T C A G G C T G A A CGAGGATGCAAGTCCTCC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |