Sequence ID | >WENV180095341 |
Genome ID | MTBK01063733 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 925 |
End posion on genome | 841 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gacaagtaat |
tRNA gene sequence |
GGGGGAGTTCCCGAGCGGCCAAAGGGGGCAGACTGTAAATCTGTTGTCAACGACTTCGGT |
Downstream region at tRNA end position |
ctgtcagccg |
Secondary structure (Cloverleaf model) | >WENV180095341 Tyr GTA t ACCA ctgtcagccg G - C G - C G - C G - C G - C A - T G - C T A T T C A C C A C G A T + | | | | A G G C C C G G T G G C G | | | T T C A G G G C A A G TGTCAACGACTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |