Sequence ID | >WENV180095342 |
Genome ID | MTBK01063733 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 790 |
End posion on genome | 705 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aagaagacct |
tRNA gene sequence |
GCCGGTGTGATGGAATGGCAGACGTGTCGCACTCAAAATGCGATGGGGACATCCCCGTGC |
Downstream region at tRNA end position |
aatcgttcaa |
Secondary structure (Cloverleaf model) | >WENV180095342 Leu CAA t ACCA aatcgttcaa G - C C - G C - G G - C G - C T - A G - C T G T C G G C C A T A A G | | | | | G G G G T A G C C G G C G | + | T T C A C G T A G G TGGGGACATCCCCGT T - A C - G G - C C - G A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |