Sequence ID | >WENV180095344 |
Genome ID | MTBK01063874 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 73 |
End posion on genome | 159 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
atattatatt |
tRNA gene sequence |
GGGCGGATGGCAGAGTGGTCAATTGCAACGGTCTGTAAAACCGTCGCCTTCATGGCTCCG |
Downstream region at tRNA end position |
aaattaaact |
Secondary structure (Cloverleaf model) | >WENV180095344 Tyr GTA t ACCA aaattaaact G - C G - C G - C C - G G - C G - C A - T T A T C G T C C A T G A G | | | | | G G G A C G G C A G G C G + | | | T T T T T G C C A A A CGCCTTCATGGCTCC A - T C - G G - C G - C T - A C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |