Sequence ID | >WENV180095347 |
Genome ID | MTBK01064106 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 7619 |
End posion on genome | 7703 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
atagaggcag |
tRNA gene sequence |
GCGAGGGTTGCCAAGCCCGGTCAAAGGCGATAGGTTGAGGGCCTATTCTCGTAGGAGTTC |
Downstream region at tRNA end position |
ctcttttgtc |
Secondary structure (Cloverleaf model) | >WENV180095347 Leu GAG g Attc ctcttttgtc G - C C - G G - C A - T G - C G - C G - C T A T C A C T C A C C G A T | | | | | G C A C C G G T G A G C G | | | T T G A G G C T C A A G TCTCGTAGGAGTTC A - T T - A A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |