Sequence ID | >WENV180095352 |
Genome ID | MTBK01064177 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 769 |
End posion on genome | 853 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gtggaagtca |
tRNA gene sequence |
GGGCGAGTGATGGAATTGGCAGACATCTATGCTTGAGGGGCATAGGAGATTGTTCTCGTG |
Downstream region at tRNA end position |
gcatgatgat |
Secondary structure (Cloverleaf model) | >WENV180095352 Leu GAG a ACtc gcatgatgat G - C G - C G - C C - G G - C A - T G + T T A T C G C C C A T A A G | | | | | A T G G T A G C G G G C G | | | T T G A C A T C A G C GGAGATTGTTCTCGT T - A A - T T - A G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |