Sequence ID | >WENV180095374 |
Genome ID | MTBK01065349 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 746 |
End posion on genome | 663 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ctagatattg |
tRNA gene sequence |
GCCGGGATGGCGGAAAAGGCAGACGCGCGGGACTTAAAATCCCGTTCTAGCAATAGAGTG |
Downstream region at tRNA end position |
aaaacaacta |
Secondary structure (Cloverleaf model) | >WENV180095374 Leu TAA g Atag aaaacaacta G - C C - G C - G G - C G - C G - C A - T T T T C T C C C A A A A G | | | | | G A G G C G G A G G G C G | | | T T G A C G C C A G G TTCTAGCAATAGAGT C - G G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |