Sequence ID | >WENV180095375 |
Genome ID | MTBK01065413 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 43616 |
End posion on genome | 43700 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gcaaacaaaa |
tRNA gene sequence |
GCCCGGATGGCGGAATTGGTAGACGCACTAGTTTCAGGGACTAGCGGGAGCAATCCTGTG |
Downstream region at tRNA end position |
ttaagagacc |
Secondary structure (Cloverleaf model) | >WENV180095375 Leu CAG a ACgt ttaagagacc G - C C - G C - G C - G G - C G - C A - T C C T T G T C C A T A A G + | | | | G T G G C G G C A G G C G | | | T T G A C G C T A G A CGGGAGCAATCCTGT C - G T - A A - T G - C T - A T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |