Sequence ID | >WENV180095379 |
Genome ID | MTBK01065448 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 209 |
End posion on genome | 294 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cagtgttttt |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGTTAAAGGCGGCAGACTGTAAATCTGCTCCCGGACGGGTTCGG |
Downstream region at tRNA end position |
ctttatccta |
Secondary structure (Cloverleaf model) | >WENV180095379 Tyr GTA t ACCA ctttatccta G - C G - C A - T G - C A - T G - C G - C T A T C C T C C A T G A G | | | | | G G G C C G G G A G G C G | | | T T T A G G C T A A G TCCCGGACGGGTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |