Sequence ID | >WENV180095389 |
Genome ID | MTBK01066427 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1230 |
End posion on genome | 1149 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
nnnnnncctt |
tRNA gene sequence |
GGAGGATTAGGCTAATTGGTAAGTCAGCGGTCTTGAAAACCGCCGCCCTCGGGCTTGGGG |
Downstream region at tRNA end position |
gctttcagcc |
Secondary structure (Cloverleaf model) | >WENV180095389 Ser TGA t GCat gctttcagcc G - C G - C A - T G - C G - C A - T T - A T G T C T C C C A T A A A | + | | | G T T C G G G G G G G C G | | + | T T G A G T C T A A CGCCCTCGGGCTT G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |