Sequence ID | >WENV180095398 |
Genome ID | MTBK01066620 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 194209 |
End posion on genome | 194281 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
gttggaaaac |
tRNA gene sequence |
GCTCTCGTAGCTTAATGGATAGAGCACCTGCTTGCGGAGCAGACGGTTGCGTGTTCGAAT |
Downstream region at tRNA end position |
tttcttttaa |
Secondary structure (Cloverleaf model) | >WENV180095398 Arg GCG c Attt tttcttttaa G - C C - G T - A C - G T - A C - G G - C T A T C G C A C A T A A A | | | | | G G T T C G G C G T G C G + | | | T T A G A G C T A A CGGTT C A C - G T - A G - C C - G T A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |