Sequence ID | >WENV180095403 |
Genome ID | MTBK01066894 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1654 |
End posion on genome | 1743 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
agcaagttac |
tRNA gene sequence |
GGAAGGGTGCCAGAGTGGACGAATGGAGCGGTCTTGAAAACCGTCGAGGGTTTGCGCCCT |
Downstream region at tRNA end position |
catcccatct |
Secondary structure (Cloverleaf model) | >WENV180095403 Ser TGA c GCCA catcccatct G - C G - C A - T A - T G - C G - C G - C T A T C A C C C A T G A G | | | | | A G G A C C G T G G G C G | | | T T A A T G G C G A A CGAGGGTTTGCGCCCTCC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |