Sequence ID | >WENV180095404 |
Genome ID | MTBK01066977 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 15336 |
End posion on genome | 15410 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ataccgcagt |
tRNA gene sequence |
GGGGACGTGGCGCAGTGGGAGCGCGCTGCCTTGGCATGGCAGAGGCCACGGGTTCGAATC |
Downstream region at tRNA end position |
cctttgttag |
Secondary structure (Cloverleaf model) | >WENV180095404 Ala GGC t ACCA cctttgttag G - C G - C G + T G - C A - T C - G G - C T A T T G C C C A G A G | | | | | G T C G C G A C G G G C G | | | | T T G G C G C G A G AGGCC C - G T - A G - C C - G C - G T T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |