Sequence ID | >WENV180095407 |
Genome ID | MTBK01067033 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 17055 |
End posion on genome | 17128 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ctggcgtgac |
tRNA gene sequence |
GGGCGTGTAGCTCAGTGGTAGAGCTCTGGTTTTACACACCAGCGGTCGGGGGTTCGAAAC |
Downstream region at tRNA end position |
tccttgtttg |
Secondary structure (Cloverleaf model) | >WENV180095407 Val TAC c ACCg tccttgtttg G - C G - C G - C C - G G - C T + G G - C A A T C T C C C A G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A T CGGTC C - G T - A G - C G - C T - A T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |