Sequence ID | >WENV180095409 |
Genome ID | MTBK01067082 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 125 |
End posion on genome | 215 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aatttcatat |
tRNA gene sequence |
GGAGGAATACCCAAGTCTGGTTGAAGGGGCCGGTCTTGAAAACCGGAAGGGTGTAAAAGC |
Downstream region at tRNA end position |
ttttaaattt |
Secondary structure (Cloverleaf model) | >WENV180095409 Ser TGA t GCCA ttttaaattt G - C G - C A - T G - C G - C A - T A - T T A T C A T C C A C T G A A | | + | | A T A C C C G T G G G C G | | | T T G A G G G T T G A G AAGGGTGTAAAAGCCGC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |