Sequence ID | >WENV180095435 |
Genome ID | MTBK01067931 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 3248 |
End posion on genome | 3164 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gttctttgat |
tRNA gene sequence |
GCCGAAGTGGCGGAATTGGTAGACGCGCACGTTTGAGGGGCGTGTGGGGCAACCCGTGCC |
Downstream region at tRNA end position |
atcctttttg |
Secondary structure (Cloverleaf model) | >WENV180095435 Leu GAG t ACCA atcctttttg G - C C - G C - G G - C A - T A - T G - C T G T C G G C C A T A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T A G G TGGGGCAACCCGT C - G A - T C - G G - C T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |