Sequence ID | >WENV180095439 |
Genome ID | MTBK01068288 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 10656 |
End posion on genome | 10729 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tcttatctcT |
tRNA gene sequence |
GGGCCTGTAGATCAGGGGTAGATCGTTGCGTTCGCAACGCAAAGGCCGCGGGTTCAAATC |
Downstream region at tRNA end position |
ctccttttga |
Secondary structure (Cloverleaf model) | >WENV180095439 Ala CGC T ATtt ctccttttga G - C G - C G + T C - G C - G T + G G - C T A T C G C C C A G A A | | | | | A G C T A G G C G G G C G | | | | T T G G A T C T A G AGGCC T - A T - A G - C C - G G - C T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |