Sequence ID | >WENV180095452 |
Genome ID | MTBK01068967 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 633 |
End posion on genome | 706 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
acagcattaa |
tRNA gene sequence |
GGCCCCGTAGCCAAGTGGTAAGGCACGGCACTGCAAATGCCTGATCGTCGGTTCAAATCC |
Downstream region at tRNA end position |
aataaatatt |
Secondary structure (Cloverleaf model) | >WENV180095452 Cys GCA a TCCA aataaatatt G - C G - C C - G C - G C - G C - G G - C T A T T G G C C A G A A + + | | | A T A C C G G T C G G C G | | | T T G A G G C T A A GATC C T G - C G - C C - G A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |