Sequence ID | >WENV180095455 |
Genome ID | MTBK01069111 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 9362 |
End posion on genome | 9461 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
agatctcccc |
tRNA gene sequence |
GGAAGCGCTCGGGGGCTGGTGTCTCCCGCGGTCTTCAAAACCGTTGTCCGGCTCCGGTCC |
Downstream region at tRNA end position |
gtttcctccc |
Secondary structure (Cloverleaf model) | >WENV180095455 SeC TCA c GCCA gtttcctccc G - C G - C A - T A - T G - C C - G G - C C - G T T T T A C C C A T C G C + | | | | G G G G G G G T G G G C G | + | | T T T C T C C G T C TGTCCGGCTCCGGTCCCGGGGTCGGGG G + T C - G G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |