Sequence ID | >WENV180095489 |
Genome ID | MTBK01071227 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 369 |
End posion on genome | 281 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
atccgcaccc |
tRNA gene sequence |
GGAGAGGTATCGAAGTGGTCATAACGGGGCTGACTCGAAATCAGTTTGGGCGCAAGCCCA |
Downstream region at tRNA end position |
cgaaattgac |
Secondary structure (Cloverleaf model) | >WENV180095489 Ser CGA c GCCA cgaaattgac G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A G T G A A | | | | | G G A G C T G T G G G C T | | + T T C A C G G A T A G TTGGGCGCAAGCCCAC G + T C - G T - A G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |