Sequence ID | >WENV180095491 |
Genome ID | MTBK01071241 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 686 |
End posion on genome | 596 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
nnnaaatatt |
tRNA gene sequence |
GGAGGGTTGGCTGAGCGGTCCAAAGCAACGGTTTGCTAAACCGTGGGGATCTAAAAGTCC |
Downstream region at tRNA end position |
gttggaaaat |
Secondary structure (Cloverleaf model) | >WENV180095491 Ser GCT t GCCA gttggaaaat G - C G - C A - T G - C G - C G - C T - A T A T C A C C C A C G A G | | | | | G G G T C G G T G G G C G | | | T T T A A G C C C A A GGGGATCTAAAAGTCCCCC A - T C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |