Sequence ID | >WENV180095503 |
Genome ID | MTBK01071828 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 6385 |
End posion on genome | 6474 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tttacagtcT |
tRNA gene sequence |
GGAGAGATGACCGAGCGGTCGAAGGTGCACGATTGGAAGTCGTGTGTACCCCGAAAGGGT |
Downstream region at tRNA end position |
ataggccgag |
Secondary structure (Cloverleaf model) | >WENV180095503 Ser GGA T GTga ataggccgag G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A C G A G | | | | | A G G C C A G A G G G C G | | | T T T A G G T C G A G TGTACCCCGAAAGGGTACC C - G A - T C - G G - C A - T T G T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |