Sequence ID | >WENV180095507 |
Genome ID | MTBK01071961 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2761 |
End posion on genome | 2667 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
tattattgat |
tRNA gene sequence |
GGGGATAGATAGGTGCTGGTGTGCCTCCTGGTCTTCAAAATCAGCTGCGGGGCGGAGACG |
Downstream region at tRNA end position |
ttttaaggag |
Secondary structure (Cloverleaf model) | >WENV180095507 SeC TCA t GCCA ttttaaggag G - C G - C G - C G + T A - T T - A A - T G A T T A C A C C C A T C G T | | | | | A G T G G A G T G G G C G + | | | T T T G C C T G T C CTGCGGGGCGGAGACGTCCTGG C - G T - A G - C G + T T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |