Sequence ID | >WENV180095512 |
Genome ID | MTBK01072594 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 8358 |
End posion on genome | 8442 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gctttagcct |
tRNA gene sequence |
GTCGGGGTGGCGGAACAGGCAGACGCGCACGCTTGAGGGGCGTGTGGTAAACACCGTGTG |
Downstream region at tRNA end position |
cgcttatgcg |
Secondary structure (Cloverleaf model) | >WENV180095512 Leu GAG t ACCA cgcttatgcg G - C T - A C - G G - C G - C G - C G - C T C T T A C C C A C A A G + | | | | G A G G C G G T G G G C G | | | T T G A C G C C A G G TGGTAAACACCGT C - G A - T C - G G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |