Sequence ID | >WENV180095530 |
Genome ID | MTBK01072991 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 29141 |
End posion on genome | 29068 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
actaaatgat |
tRNA gene sequence |
GGTGTCGTAGCTCAGTCGGTAGAGCAACGGACTGAAAATCCGTGTGTCGCTGGTTCGATT |
Downstream region at tRNA end position |
attcggcgat |
Secondary structure (Cloverleaf model) | >WENV180095530 Phe GAA t ACtc attcggcgat G - C G - C T - A G - C T - A C - G G - C T T T C G C C C A T G A A | | | | G C C T C G G C T G G C G | | | | T T G G A G C T A A GTGTC A - T C - G G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |