Sequence ID | >WENV180095533 |
Genome ID | MTBK01073117 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 112 |
End posion on genome | 24 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ggcgcttttt |
tRNA gene sequence |
GGAGAGATGTCCGAGTGGTTGAAGGTGCACGCTTGGAAAGCGTGTGTAGGCTTATACCCT |
Downstream region at tRNA end position |
ataacttctg |
Secondary structure (Cloverleaf model) | >WENV180095533 Ser GGA t GCaa ataacttctg G - C G - C A - T G - C A - T G - C A - T T A T G C C C C A T G A G | | | | | G G G C C T C G G G G C G | | T T T A G G T T G A G TGTAGGCTTATACCCTACC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |