Sequence ID | >WENV180095550 |
Genome ID | MTBK01073737 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 701 |
End posion on genome | 785 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tcggagagat |
tRNA gene sequence |
GGGGGAATGTCCCGAGCGGCAAAGGGGGCGGACTGTAAATCCGCTGGCTAAGCCTTCGTA |
Downstream region at tRNA end position |
tctccaaccc |
Secondary structure (Cloverleaf model) | >WENV180095550 Tyr GTA t ACCA tctccaaccc G - C G - C G - C G - C G - C A - T A - T T G T C A T C C A G A G G | | | | | G C C C C T G T A G G C G | | + T T G A G G G C A A G TGGCTAAGCCTTC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |