Sequence ID | >WENV180095555 |
Genome ID | MTBK01073995 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 4288 |
End posion on genome | 4215 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
cacgcaatat |
tRNA gene sequence |
TGCGGGGTAGAGCAGTTGGTAGCTCGTCGGGCTCATAACCCGGAGGTCGCAAGTTCGAGT |
Downstream region at tRNA end position |
gaaacccttt |
Secondary structure (Cloverleaf model) | >WENV180095555 fMet CAT t ACta gaaacccttt T T G - C C - G G - C G - C G - C G - C T G T C G T T C A T G A A | | | | | G T C G A G G C A A G C G | | | | T T G G C T C T A G AGGTC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |