Sequence ID | >WENV180095571 |
Genome ID | MTBK01075457 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 24711 |
End posion on genome | 24628 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tcgacgggcc |
tRNA gene sequence |
GCGGGCGTGGCGAAATGGCAGACGCGATGGCTTTAGGTGCCATTGCTCGAAAGAGCGTGT |
Downstream region at tRNA end position |
aagctgttcg |
Secondary structure (Cloverleaf model) | >WENV180095571 Leu TAG c ACtc aagctgttcg G - C C - G G - C G - C G - C C - G G - C T G T C T C C C A T A A G | | | | G G A G C G G T G G G C G | | | T T C A C G C A G G TGCTCGAAAGAGCGT A - T T - A G - C G - C C - G T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |