Sequence ID | >WENV180095586 |
Genome ID | MTBK01077039 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 14621 |
End posion on genome | 14692 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
tttcacgctg |
tRNA gene sequence |
GGGCCCGTAGCTCAATGGCGGAGCAGGCGGCTCATAACCGCTTGGTTGTTGGTTCGAATC |
Downstream region at tRNA end position |
tttatttaag |
Secondary structure (Cloverleaf model) | >WENV180095586 Ile2 CAT g Atgt tttatttaag G - C G - C G - C C - G C - G C - G G - C T A T C T A C C A A A A | | | | G T C T C G G T T G G C G | | | | T T G G A G C C G A TGGTT G + T G - C C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |