Sequence ID | >WENV180095588 |
Genome ID | MTBK01077039 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 202484 |
End posion on genome | 202558 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tcagcaactT |
tRNA gene sequence |
GCCCCAGTGGCTCAATGGATAGAGCAAGGCACTCCTAACGCCTGGATTGGGGGTTCGATT |
Downstream region at tRNA end position |
aagaaaaaca |
Secondary structure (Cloverleaf model) | >WENV180095588 Arg CCT T ATaa aagaaaaaca G + T C - G C - G C - G C - G A - T G - C T T T C T C C C A T A A G | + | | | G G C T C G G G G G G C G | | | | T T A G A G C T A A GGATT A - T G - C G - C C - G A C C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |