Sequence ID | >WENV180095596 |
Genome ID | MTBK01077039 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 355261 |
End posion on genome | 355190 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tagagcttac |
tRNA gene sequence |
GCGGGTGTTGCCAAGCGGTAAGGCATTAGCTTCCCAAGCTAACATTCGTGGGTTCGAATC |
Downstream region at tRNA end position |
aaaaacaact |
Secondary structure (Cloverleaf model) | >WENV180095596 Gly CCC c Ttta aaaaacaact G - C C - G G - C G - C G - C T - A G - C T A T T A C C C A G A T + | | | | G C A C C G G T G G G C G | | | T T G A G G C T A A CATTC T - A T - A A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |