Sequence ID | >WENV180095597 |
Genome ID | MTBK01077039 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 299822 |
End posion on genome | 299750 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
cattccacac |
tRNA gene sequence |
GCCAACGTAGCTCAGTCGGTAGAGCAGACGCTTCGTAAGCGCCCGGTCGGGGGTTCGATT |
Downstream region at tRNA end position |
caaaaaagag |
Secondary structure (Cloverleaf model) | >WENV180095597 Thr CGT c Ttat caaaaaagag G - C C - G C - G A - T A - T C - G G - C T T T T T C C C A T G A A + + | | | G C C T C G G G G G G C G | | | | T T G G A G C T A A CGGTC G - C A C C - G G - C C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |