Sequence ID | >WENV180095602 |
Genome ID | MTBK01077597 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 471 |
End posion on genome | 557 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tttgttaatt |
tRNA gene sequence |
GCCGTGGTGGCGGAATGGTATACGCGGTGGTCTCAAAAACCACTGGGATTTAATCCCGTG |
Downstream region at tRNA end position |
gcatttttgg |
Secondary structure (Cloverleaf model) | >WENV180095602 Leu CAA t ACCA gcatttttgg G - C C - G C - G G - C T - A G - C G - C T C T C A C C C A T A A G | | | | | G G G G C G G T G G G C G | | | T T T A C G C A T G TGGGATTTAATCCCGT G - C T - A G - C G - C T - A C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |