Sequence ID | >WENV180095618 |
Genome ID | MTBK01078091 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2325 |
End posion on genome | 2232 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
atggtggcac |
tRNA gene sequence |
GGAGAGATGGCCGAGTTGGACGAAGGCGCTCGACTCGAAATCGAGTAAGTGGTGATGAGC |
Downstream region at tRNA end position |
gattataaaa |
Secondary structure (Cloverleaf model) | >WENV180095618 Ser CGA c GCCA gattataaaa G - C G - C A - T G - C A - T G - C A - T T A T G T C C C A T T G A G | | | | | G G G C C G C A G G G C G | | | T T A A G G C C G A G TAAGTGGTGATGAGCCGCTTC C - G T - A C - G G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |