Sequence ID | >WENV180095630 |
Genome ID | MTBK01078481 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 165 |
End posion on genome | 250 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ttctccactt |
tRNA gene sequence |
GCGCGAGTGGCGGAATTGGCAGACGCGCTGGATTCAGGTTCCAGTGTTCGAAAGGACGTG |
Downstream region at tRNA end position |
cagatgtcgc |
Secondary structure (Cloverleaf model) | >WENV180095630 Leu CAG t ACCg cagatgtcgc G - C C - G G - C C - G G - C A - T G - C T G T C C C C C A T A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C C A G G TGTTCGAAAGGACGT C - G T - A G - C G - C A - T T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |