Sequence ID | >WENV180095634 |
Genome ID | MTBK01078953 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1157 |
End posion on genome | 1231 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
catctacaat |
tRNA gene sequence |
AGGCGCGTAGCTCAGTGGGAGAGCGCTACCTTGACGCGGTAGAGGTCGCCGGTTCAATAC |
Downstream region at tRNA end position |
ttaaaatcaa |
Secondary structure (Cloverleaf model) | >WENV180095634 Val GAC t ACCA ttaaaatcaa A - T G - C G - C C - G G - C C - G G - C A T T C A G C C A G A A | | | | A T C T C G G C C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A A - T C - G C - G T C T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |