Sequence ID | >WENV180095637 |
Genome ID | MTBK01079181 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 178 |
End posion on genome | 263 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aatacagaat |
tRNA gene sequence |
GGAAAGGTGGCCGAGTGGACGATGGCGGAGGTCTTGAAAGCCTTATTACGAAAGTAACGC |
Downstream region at tRNA end position |
atctttttat |
Secondary structure (Cloverleaf model) | >WENV180095637 Ser TGA t GCCA atctttttat G - C G - C A - T A - T A - T G - C G - C T A T C G T C C A T G A G | | | | | G G G C C G G C A G G C G + | | | T T A T G G C C G A G ATTACGAAAGTAAC G + T A - T G - C G - C T + G C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |